For the analysis of TNF, CD3e, CD3z and CD2 gene expressions, total RNA from 5 × 10 5 cells (RAW) and 50'000 cells (Liver cells) were isolated using TRIzol Reagent (Invitrogen) following the manufacturer's protocol. RNA was eluted in 12 µL of nuclease-free water and the quantity of extracted RNA was evaluated using NanoDrop 2000c spectrometer (ThermoFischer Scientific). A total of 500 ng of total RNA was converted to cDNA using iScript cDNA Synthesis Kit ,
, Figure 2?figure supplement 3. siRNA knockdown efficiencies of three different siRNAs for each gene., Real-Time PCR Systems (Applied Biosystems) using standard thermal cycling conditions and SYBR green assays specific for mTNF-a (F: CCACCACGCTCTTCTGTCTA, R: AGGGTCTGGGCCATAGAACT), mCD3e (F: CTGGTGCCTTCTTCAGAAATG, R: AGGATGCCCCAGAAAGTGTT), mCD3z (F: ATCCCA GGGAAGCAGAAGAT, R: AGAGTTTGGGATCCAGCAGA), and CD2 (F: TCTGCTCTTCAGCCTTTCCG, R: CTCCTTACCCATCGCACCTC)
, Figure 2?source data 2. ANOVA analyses and Bonferroni's multiple comparison tests for Figure 2A.
BCG vaccination scar associated with better childhood survival in Guinea-Bissau, International Journal of Epidemiology, vol.34, issue.3, pp.540-547, 2005. ,
BCG Vaccination Protects against Experimental Viral Infection in Humans through the Induction of Cytokines Associated with Trained Immunity, Cell Host & Microbe, vol.23, issue.1, pp.89-100.e5, 2018. ,
BCGitis and BCGosis in children with primary immunodeficiency ? imaging characteristics, Pediatric Radiology, vol.46, issue.2, pp.237-245, 2015. ,
Bacillus Calmette-Guerin Infection in NADPH Oxidase Deficiency: Defective Mycobacterial Sequestration and Granuloma Formation, PLoS Pathogens, vol.10, issue.9, p.e1004325, 2014. ,
Does BCG vaccination protect against childhood asthma? Final results from the Manchester Community Asthma Study retrospective cohort study and updated systematic review and meta-analysis, Journal of Allergy and Clinical Immunology, vol.133, issue.3, pp.688-695.e14, 2014. ,
TNF, TNF inducers, and TNFR2 agonists: A new path to type 1 diabetes treatment, Diabetes/Metabolism Research and Reviews, vol.34, issue.1, p.e2941, 2017. ,
Bacillus Calmette-Guérin Strain Differences Have an Impact on Clinical Outcome in Bladder Cancer Immunotherapy, European Urology, vol.66, issue.4, pp.677-688, 2014. ,
Concurrent granulomatous hepatitis, pneumonitis and sepsis as a complication of intravesical BCG immunotherapy, Case Reports, vol.2013, issue.oct09 3, pp.bcr2013200624-bcr2013200624, 2013. ,
Management of Hepatic Granulomatous Tuberculosis After BCG Therapy for Bladder Cancer, Urology Case Reports, vol.13, pp.158-159, 2017. ,
Tumor necrosis factor-? is required in the protective immune response against mycobacterium tuberculosis in mice, Immunity, vol.2, issue.6, pp.561-572, 1995. ,
Roles of Soluble and Membrane TNF and Related Ligands in Mycobacterial Infections: Effects of Selective and Non-selective TNF Inhibitors During Infection, Advances in Experimental Medicine and Biology, vol.691, pp.187-201, 2010. ,
URL : https://hal.archives-ouvertes.fr/hal-00591934
TNF signaling drives myeloid-derived suppressor cell accumulation, Journal of Clinical Investigation, vol.122, issue.11, pp.4094-4104, 2012. ,
Soluble TNFRp75 regulates host protective immunity against Mycobacterium tuberculosis, Journal of Clinical Investigation, vol.124, issue.4, pp.1537-1551, 2014. ,
Innate myeloid cell TNFR1 mediates first line defence against primary Mycobacterium tuberculosis infection., Scientific Reports, vol.6, issue.1, p.22454, 2016. ,
Transmembrane Tumor Necrosis Factor Controls Myeloid-Derived Suppressor Cell Activity via TNF Receptor 2 and Protects from Excessive Inflammation during BCG-Induced Pleurisy, Frontiers in Immunology, vol.8, p.999, 2017. ,
URL : https://hal.archives-ouvertes.fr/hal-02126469
Differential Effects of Total and Partial Neutralization of Tumor Necrosis Factor on Cell-Mediated Immunity to Mycobacterium bovis BCG Infection, Infection and Immunity, vol.73, issue.6, pp.3668-3676, 2005. ,
TNF Regulates Chemokine Induction Essential for Cell Recruitment, Granuloma Formation, and Clearance of Mycobacterial Infection, The Journal of Immunology, vol.168, issue.9, pp.4620-4627, 2002. ,
Soluble TNF, but not membrane TNF, is critical in LPS-induced hepatitis, Journal of Hepatology, vol.53, issue.6, pp.1059-1068, 2010. ,
A TNF-Regulated Recombinatorial Macrophage Immune Receptor Implicated in Granuloma Formation in Tuberculosis, PLoS Pathogens, vol.7, issue.11, p.e1002375, 2011. ,
In vivo natural killer cell activities revealed by natural killer cell-deficient mice, Proceedings of the National Academy of Sciences, vol.97, issue.6, pp.2731-2736, 2000. ,
CD1d-Restricted and TCR-Mediated Activation of V?14 NKT Cells by Glycosylceramides, Science, vol.278, issue.5343, pp.1626-1629, 1997. ,
Invariant NKT Cells in Hyperplastic Skin Induce a Local Immune Suppressive Environment by IFN-? Production, The Journal of Immunology, vol.184, issue.3, pp.1242-1250, 2009. ,
Interaction of TNF with TNF Receptor Type 2 Promotes Expansion and Function of Mouse CD4+CD25+ T Regulatory Cells, The Journal of Immunology, vol.179, issue.1, pp.154-161, 2007. ,
Natural regulatory T cells: mechanisms of suppression, Trends in Molecular Medicine, vol.13, issue.3, pp.108-116, 2007. ,
Eukaryotic elongation factor 2 controls TNF-? translation in LPS-induced hepatitis, Journal of Clinical Investigation, vol.123, issue.1, pp.164-178, 2012. ,
Atypical MHC class II-expressing antigen-presenting cells: can anything replace a dendritic cell?, Nature Reviews Immunology, vol.14, issue.11, pp.719-730, 2014. ,
Tuberculosis associated with infliximab, a tumor necrosis factor alpha-neutralizing agent, N Engl J Med, vol.345, pp.1098-104, 2001. ,
Effects of Tumor Necrosis Factor Alpha on Host Immune Response in Chronic Persistent Tuberculosis: Possible Role for Limiting Pathology, Infection and Immunity, vol.69, issue.3, pp.1847-1855, 2001. ,
High sensitivity of transgenic mice expressing soluble TNFR1 fusion protein to mycobacterial infections: Synergistic action of TNF and IFN-? in the differentiation of protective granulomas, European Journal of Immunology, vol.27, issue.12, pp.3182-3190, 1997. ,
Tumor necrosis factor neutralization combined with chemotherapy enhances Mycobacterium tuberculosis clearance and reduces lung pathology, Am J Clin Exp Immuno, vol.2, pp.124-134, 2013. ,
Adjunctive TNF Inhibition with Standard Treatment Enhances Bacterial Clearance in a Murine Model of Necrotic TB Granulomas, PLoS ONE, vol.7, issue.6, p.e39680, 2012. ,
Transmembrane TNF Induces an Efficient Cell-Mediated Immunity and Resistance toMycobacterium bovisBacillus Calmette-Guérin Infection in the Absence of Secreted TNF and Lymphotoxin-?, The Journal of Immunology, vol.168, issue.7, pp.3394-3401, 2002. ,
Contribution of Transmembrane Tumor Necrosis Factor to Host Defense against Mycobacterium bovis Bacillus Calmette-Guerin and Mycobacterium tuberculosis Infections, The American Journal of Pathology, vol.166, issue.4, pp.1109-1120, 2005. ,
Membrane-Bound TNF Induces Protective Immune Responses to M. bovis BCG Infection: Regulation of memTNF and TNF Receptors Comparing Two memTNF Molecules, PLoS ONE, vol.7, issue.5, p.e31469, 2012. ,
Tumor Necrosis Factor and Its Receptors Are Crucial to Control Mycobacterium bovis Bacillus Calmette-Guerin Pleural Infection in a Murine Model, The American Journal of Pathology, vol.186, issue.9, pp.2364-2377, 2016. ,
Memory of Natural Killer Cells: A New Chance against Mycobacterium tuberculosis?, Frontiers in immunology, vol.8, p.967, 2017. ,
Natural killer cells in liver disease, Hepatology, vol.57, issue.4, pp.1654-1662, 2013. ,
An Anti-Inflammatory Role for V?14 NK T cells in Mycobacterium bovis Bacillus Calmette-Guérin-Infected Mice, The Journal of Immunology, vol.171, issue.4, pp.1961-1968, 2003. ,
Cutting Edge: Expression of TNFR2 Defines a Maximally Suppressive Subset of Mouse CD4+CD25+FoxP3+ T Regulatory Cells: Applicability to Tumor-Infiltrating T Regulatory Cells, The Journal of Immunology, vol.180, issue.10, pp.6467-6471, 2008. ,
Modulation of Regulatory T Cell Activity by TNF Receptor Type II-Targeting Pharmacological Agents, Frontiers in Immunology, vol.9, p.594, 2018. ,
Much More than M1 and M2 Macrophages, There are also CD169(+) and TCR(+) Macrophages, Frontiers in immunology, vol.6, p.263, 2015. ,
TCR? Combinatorial Immunoreceptor Expression by Neutrophils Correlates with Parasite Burden and Enhanced Phagocytosis during a Plasmodium berghei ANKA Malaria Infection, Infection and Immunity, vol.86, issue.7, 2018. ,
TCR?-expressing macrophages induced by a pathogenic murine malaria correlate with parasite burden and enhanced phagocytic activity, PLOS ONE, vol.13, issue.7, p.e0201043, 2018. ,
A combinatorial ?? T cell receptor expressed by macrophages in the tumor microenvironment, Immunobiology, vol.222, issue.1, pp.39-44, 2017. ,
Chronic Inflammation Increases the Sensitivity of Mouse Treg for TNFR2 Costimulation, Frontiers in Immunology, vol.8, p.1471, 2017. ,
Comparison of Frequency of Periprocedural Myocardial Infarction in Patients With and Without Diabetes Mellitus to Those With Previously Unknown but Elevated Glycated Hemoglobin Levels (from the TWENTE Trial), The American Journal of Cardiology, vol.110, issue.11, pp.1561-1567, 2012. ,